okbirdman 的最愛

On a clementine orange.

This in interesting because both the common Penicillium species on oranges are in this image. The faster growing, paler green one covering most of the fruit is P. digitatum. The powdery, more blue colony at the top of the fruit is P. italicum.

Several large groups wintering in a hollowed redwood, as is common for this species (see here). Very cool to see such a wide range of variability among these individuals!

The main image is a composite I made (overlay) of the brittle star bioluminescencing in the dark and the image of the brittle star hit with a flash. I had read that Amphipholis squamata had bioluminescence but hadn't seen any images from the California coast, so I brought home a few from the docks at Jack London and took lots of photos, some 30 minutes long at my highest ISO and got nothing. I did some more reading and 200mM KCl can cause a depolarization event leading to extreme bioluminescence so I dissolved a Emergen-C vitamin fizzy drink that has potassium carbonate in it in a minimal amount of water and added that to a few isolated brittle stars and BAM! Light show!

Several dozens observed under flat piece of waste asphalt just above wrack line, near edge of mud flats. Tons of amphipods and sea slaters alongside them. Found a number of mouse-eared snails in the mix as well.
Overview of species

Terrible pictures. ~3 cm in length, mostly staying in place among shallow algae. Overall impression (tapered head with upturned mouth, rounded caudal fin) looks most to me like Fundulidae. Markings remind me of Lucania goodei (olive above, white below with wide black lateral line, dark base of dorsal fin). I think that salinity is too high in Ballena Bay for this species, and I think this species is uncommon in its introduced region of California, but I don't have any other strong theories.

First known wild observations and discovery of natural fluorescent in an old world mammal or any mammal outside of North and Central America, images of the Springhare taken in August 2019. Incredible to see it’s orange and pink glow firsthand, especially when it wasn’t expected! Accidental discovery whilst out photographing scorpions under UV light

Shot using a Nikon D850 Handheld with a Nitecore Chameleon C6 ( 365nm ) torch.

For anyone interested in February 2020 a Scientific journal was released by a American research group ( no relation to me ) about this UV trait and science behind it from research in museum & zoo specimens in the US.

There are a few more images, but you might be able to imagine photographing a rather skittish nocturnal creature on foot with a UV torch in one hand and a large DSLR in the other during a unexpected encounter whilst also trying to expose a camera correctly for UV light isn’t the easiest thing to do the split second.

On Rosa sp.

According to this observation, this is part of a known group of Diplolepis that are not quite consistent with D. polita. I will keep this at genus level until molecular work clarifies the relationship, unless it would make more sense to assign this to D. polita in order to atlas this group for subsequent taxon swaps

Identification as E. schoenherri confirmed by Alexander Riedel (State Museum of Natural History Karlsruhe). The Arfak population represents subspecies petiti (see photo in www.papua-insects.nl/insect%20orders/Coleoptera/Curculionoidea/Curculionidae/Eupholus%20schoenherri%20petiti.jpg). Habitat: understory of primary montane forest at 1800 m elev.

I highly recommend taking a look at this fascinating article on the remarkable rediscovery of Scyphacella arenicola by Dr. Pallieter De Smedt, featured on the Smithsonian's Website!

https://naturalhistory.si.edu/research/invertebrate-zoology/news-and-highlights/isopod-rediscovery

This is the second beach, out of four, with the species.

There is a major die-off of Eucalyptus on Albany Hill. Isolating fungi from the leaf lesions yielded this culture, which is a known pathogen elsewhere. It grows as sort of a yeasty black culture.

ITS sequence: AAGGATCATTAAAGAGTAAGGGGCTAAACACCCCGACCTCCAACCCTCTGTTGTTAAAACTACCTTTGTTGCTTTGGCGGGACCGCTCGGTTCCGAGCCGCCAGGCCCCCTCACCGGGGTCGCGGCGAGTTCCCGCCAGAGTTAAACCAAACTCTTGTTATATAAACCGGTCGTCTGAGTAAAAATTTTGAATTAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCATTGCTTGGTATTGGGCTCACCGTCCCCGCCAGTCGGGGGCGTGCCTCAAACACCTCGGCGGAGCCTCACCGGCTTTGGGCGTAGTAGATTTTCTAATAACGTCCTTTAACGGAGAGTGCTTCTTTGCCGATTGAAGACTTACACTTCTTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA

Alameda Salt Marsh Song Sparrow (Melospiza melodia ssp. pusillula), photographed at Alviso Marsh in Alviso Marina County Park. Identiified as such from the bird's very heavy, dark streaking and its location in one of the South Bay's salt marshes.

Alviso Marina County Park is located in the Alviso district of San Jose, CA, in northern Santa Clara County. It is an excellent place to look for Alameda Salt Marsh Song Sparrow, as well as other salt marsh specialists.

References:
1) Chan, Yvonne, and Spautz, Hildie, "Alamda Salt Marsh Song Sparrow." California Bird Species of Special Concern, 2008. Pp. 419 - 424.
2) Nur, Nadav, et. al., "Tidal Marsh Song Sparrows of San Francisco Bay," 2002. Pp. 1-4
3) Rising, James D., The Sparrows of the United States and Canada. Academic Press, 1996, pp. 190 - 195.

Red-winged Blackbird
near Stewardson, Illinois
1 June 1989

I'm posting this record just for the general interest of a Red-winged Blackbird with one white wing. Whether a partial albino, or a partial leucistic bird, I'm not sure. A local farmer told my wife and me that this bird had been on his farm for three summers. The bird left in the fall with the other Red-wingeds and came back in the spring. I watched it for about 30 minutes. It vocalized like any other Red-winged BB and interacted with other Red-wingeds normally. It was pretty flashy to see in flight, however. Three shots posted. These images scanned from old color slides.

In the peak of the top end dry season. A mantis crashed into the spotlight of my parked vehicle and fell on the ground, stunned. The katydid immediately arrived and began eating it. This is a dried up creek bed and the nearby vegetation is extremely dry - perhaps the katydid desperately needed the moisture. Bowerbird.org.au sighting being moved to iNaturalist as the former website is shutting down.