naturalisttrent 的最愛

In Tilden Park on dead Bay Laural. I originally thought it was a Stereum sp. but it looked a little different, and the host was usual. The specimen, which was almost completely resupinate, pealed off easily from the wood. The first photo is the dried specimen, the next two are dissection scope views. Cystidia are at 400X, spores at 1000X. Spores 7 X 11 (ave of 5), with a transparent outer part. Cystidia numerous, thickwalled, and incrusted with crystals. Clamp connections occasional. The ITS sequence is a nearly exact match:
AAGGATCATTAACGAGTCTTGAAAGGGTTGTAGCTGGCCTCCCGAGGCACGTGCACGCCCGCTCATCCGCTCTACACCTGTGCACCATTGTAGGTCGGTCGTGCGGGCGCCCCTCTTCTGGGGCGCTCGAGCGGTCTTCCTATGTAACACCACACACCATGCAGTATCGGAACGACGACGCGATAATACGCATCTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTCGGTATTCCGTGGAGCATGCCTGTTTGAGTGTCATGAAATTCTCAAACCCCTATCCCTTGTGGAGAGCGGGCTTGGACTTGGAGGCTTGCCGGCCGTCGTGGTCGGCTCCTCTCGAATGCATCAGCTCGATTCCTTGCGGATCGGCTCTCGGCGTGATAATTGTCTACGTCGTGACCGTGAAGCGTCTGGCGGGCTTCTAACCGTCCCTTCGAGGACAACCCTTCGAATCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA

When I cut it in half it quickly stained dark blue. Later that evening the blue disappeared, however it reappeared again when I scraped it with a knife. The odor and taste of both the cap and stipe were mild and indistinct. It was medium firm and was moist, but not at all slimy.

Eggs like these were mostly scattered inch or more apart; this is a rare clump. Under (I think) cattail fronds in moist area (usually would have standing water this time of year). Each egg approx 2mm long.

Could this be A. asmodaeus (Bond, 2012: known only from type locality Mt. Diablo)?

Est. 2cm BL, found in oak/mixed duff by @leftcoastnaturalist. It was non-responsive, so dead (but soft/flexible) or doing a very good job at playing dead.
More photos at https://bugguide.net/node/view/1476644/bgimage

This was on the ceiling inside my house right above where I work. It was about 2" wide, including its legs, so the main part of it was about 3/4". I photographed it right where it was found on the ceiling, and then my son trapped it in a plastic cup before relocating it outside, and I photographed it in the cup with a white paper towel in the background, which made the details stand out. I couldn't get a shot of its eyes straight on, but it looks from my angle above it in the cup that it had 8 evenly spaced eyes. @rjadams55 , is this a Liocranid? Are those long tarsal claws on its hind legs or not? I was looking at plate 29 on your book, and some of the spiders on that page look similar, but they seem like they are smaller than the one I saw. There's this spider that looks similar (hard to tell w/the quality of this photo) that was also seen in SLO: http://bugguide.net/node/view/488050

Habitat: Roadside, Oak Woodland
Substrate: Duff
Cap: 5.5" (14 cm) h x.75" (2 cm) thick, plane, pale butter yellow, translucent, dry, striated at the margin, white warts, sparser toward the center, white flesh, did not discolor, mild smell
Gills: white, adnexed, no latex, no bruising
Stipe: 4" h (10 cm) x 1-1.75" (2.5-4.5 cm) thick solid white, smooth, dry, tapered at the top, pronounced basal bulb, looks like an egg cup (volva), no ring present, no bruising, mild smell, snapped like chalk, very short striations at the very top of stipe